human macrophage mannose receptor rhmmr cd206  (R&D Systems)

Journal: Carbohydrate polymers

Article Title: The immunogenicity of p24 protein from HIV-1 virus is strongly supported and modulated by coupling with liposomes and mannan.

doi: 10.1016/j.carbpol.2024.121844

Figure Lengend Snippet: Fig. 2. Interaction of p24 protein and mannan with liposomes. A) The scheme of the specific immunogold staining of p24 and mannan molecules. Anti-V5 antibody was used for detection of p24 antigen, whereas His-tagged recombinant mannose receptor and anti-HisTag antibody were used for the detection of mannan molecules on the surface of liposomes. B) Analysis of p24 binding on metallochelating liposomes, or C) p24 binding on mannosylated liposomes using isothermal titration. In the negative controls experiments, where no reaction enthalpy is observed, the results are shown as non-binding. Thermodynamic parameters of interaction between p24 antigen and metallochelation liposomes or mannosylated liposomes are shown in the inserted table. D) Overview image of p24 protein on the surface of liposomes visualized by anti-V5 antibody detected by protein A gold-nanoparticles. E) Detail of single liposome with immunogold stained surface p24 protein. F) p24 mannosylated liposome stained with MMR (His tagged recombinant human mannose receptor CD206) – anti-HisTag antibody – Protein A gold nanoparticles. G) Control non-stained p24 mannosylated liposomes. H) Control - p24 mannosylated liposome stained with Protein A gold nanoparticles, without MMR – HisTag antibody. I) Control - p24 mannosylated liposome stained with MMR – Protein A gold nanoparticles, without HisTag antibody.

Article Snippet: Briefly, 4 μg of recombinant human mannose receptor CD206 (MMR, R&D Systems; Minneapolis, USA) was mixed with 3 mg of mannosylated liposomes (10 mg/ml PBS).

Techniques: Liposomes, Staining, Recombinant, Binding Assay, Titration, Control

Journal: Marine Drugs

Article Title: Immune Modulating Brevetoxins: Monocyte Cytotoxicity, Apoptosis, and Activation of M1/M2 Response Elements Is Dependent on Reactive Groups

doi: 10.3390/md20040233

Figure Lengend Snippet: THP-1 monocyte cell-surface expression of key inflammatory response elements. THP-1 monocytes were treated with the four brevetoxin analogs and assessed for cell-surface expression of CD80 (Panel A ), CD206 (Panel B ), TLR4 (Panel C ), and IL4Ra (Panel D ) by flow cytometry. Data is presented as mean ± standard deviation ( n = 3), with * indicating statistically significant difference from vehicle control (VC) ( p < 0.05).

Article Snippet: Fc receptors were blocked using 75 µL of goat serum (Gibco, Waltham, MA, USA) then stained with the following fluorescent antibodies: Toll-Like Receptor 4 (TLR4) mouse anti-human conjugated to BV421, Mannose Receptor (CD206) mouse anti-human conjugated to PE-CF594, Interleukin 4 Receptor (IL4Ra) mouse anti-human conjugated with BV510, and CD80 mouse anti-human conjugated with APC-H7, all from BD Biosciences (BD Biosciences, Franklin Lakes, NJ, USA).

Techniques: Expressing, Flow Cytometry, Standard Deviation

Journal: bioRxiv

Article Title: High mannose N-glycans on red blood cells as phagocytic ligands, mediating both sickle cell anaemia and resistance to malaria

doi: 10.1101/2020.11.26.399402

Figure Lengend Snippet: a) Oxidized RBCs stained with Cell Trace Far Red (CTFR, red) are incubated with HMDM for 3 hours, washed with PBS, permeabilized and stained for nucleus (DAPI, blue). Immunofluorescence. Scale bar shown. b) Oxidized RBCs stained with Cell Trace Far Red (CTFR, red) are incubated with HMDM for 3 hours, washed with PBS, and counter-stained prior to immunofluorescence microscopy with anti-GPA-FITC antibody (green) to identify RBCs that are not sequestered inside macrophages: GPA-FITC only (i), GPA-FITC and CTFR (ii), bright field only (iii) and merged (iv). CTFR (red) single positive cells are counted as having been phagocytosed (letter E). Double positive (CTFR and GPA) cells are not counted as having been phagocytosed, but bound to the macrophage cell surface. Scale bar 50 μm scale as shown. c) Mannose receptor (CD206) expression assessed by microscopy for human monocyte derived macrophages treated with siRNA or scramble control. Mann-Whitney. d) Percentage surface binding of HbSS RBCs assessed by microscopy for human monocyte derived macrophages treated with siRNA or scramble control. e) Quantified phagocytosis beads by HMDM with and without glycan polymer blockade, applied in the same way and the same concentration as for RBC phagocytosis experiments.

Article Snippet: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax, Life Technologies) (n = 4 donors for all siRNA experiments).

Techniques: Staining, Incubation, Immunofluorescence, Microscopy, Expressing, Derivative Assay, MANN-WHITNEY, Binding Assay, Concentration Assay